| Sequence ID | >WENV170740788 |
| Genome ID | LULS01000163 |
| Phylum/Class | [LULS] marine metagenome; Red Sea water column Station 108 - depth 200m |
| Species | |
| Start position on genome | 12 |
| End posion on genome | 86 |
| Amino Acid | Ile |
| Anticodon | GAT |
| Upstream region at tRNA start position |
aaatttttca |
| tRNA gene sequence |
GGGCTCGTAGCTCAGCTTGGCTGGAGCGTTCGACTGATAATCGAAAGGTCATGAGTTCGA |
| Downstream region at tRNA end position |
ttctttaaat |
| Secondary structure (Cloverleaf model) | >WENV170740788 Ile GAT
a Atat ttctttaaat
G - C
G - C
G - C
C - G
T + G
C - G
G - C T A
T T A C T C A
T C G A A | | | | | G
T C T C G A T G A G C
G | | | | T T
G G A G C
C T G G AGGTC
T - A
T - A
C - G
G - C
A - T
C A
T A
G A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |