Sequence ID | >WENV170741020 |
Genome ID | LULS01004390 |
Search identical group | |
Phylum/Class | [LULS] marine metagenome; Red Sea water column Station 108 - depth 200m |
Species | |
Start position on genome | 1748 |
End posion on genome | 1823 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
gattttctaT |
tRNA gene sequence |
GGGCCGGTCGTCTAGACTGGTAGGATACGCCCTTGGCATGGGTGAGATCGAGGGTTCAAA |
Downstream region at tRNA end position |
catatttttt |
Secondary structure (Cloverleaf model) | >WENV170741020 Ala GGC T ATta catatttttt G - C G - C G + T C - G C - G G - C G - C T A T C T C C C A A G A C | | | | | A C T C T G G A G G G C T + | | + T T G G G A T G T A A AGATC C - G G + T C - G C - G C - G T T T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |