Sequence ID | >WENV170743531 |
Genome ID | LULW01000364 |
Search identical group | |
Phylum/Class | [LULW] marine metagenome; Red Sea water column Station 108 - depth 10m |
Species | |
Start position on genome | 5328 |
End posion on genome | 5421 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
ggggctgcat |
tRNA gene sequence |
GGAGGCGTCGCCTAGTCAGGTCTATGGCGCCCGCCTGCTAAGCGGGTTTGGGGCTACAAC |
Downstream region at tRNA end position |
gcctcggccc |
Secondary structure (Cloverleaf model) | >WENV170743531 Ser GCT t GCCG gcctcggccc G - C G - C A - T G - C G - C C - G G - C T A T C T C C C A C T G A C | | | | | A A T C C G G A G G G C G | | | T T G T G G C T C T A G TTTGGGGCTACAACCCCATC C - G C - G C - G G - C C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |