| Sequence ID | >WENV170744089 |
| Genome ID | LULW01021604 |
| Phylum/Class | [LULW] marine metagenome; Red Sea water column Station 108 - depth 10m |
| Species | |
| Start position on genome | 170 |
| End posion on genome | 246 |
| Amino Acid | Met |
| Anticodon | CAT |
| Upstream region at tRNA start position |
aacaatcgga |
| tRNA gene sequence |
GGCTACGTAGCTCAGTTGGTTAGAGCACATCACTCATAATGATGGGGTCGCAAGTTCGAA |
| Downstream region at tRNA end position |
ttctcgcaaa |
| Secondary structure (Cloverleaf model) | >WENV170744089 Met CAT
a ACCA ttctcgcaaa
G - C
G - C
C - G
T - A
A - T
C - G
G - C T A
T C G C T C A
T G A A | | | | G
T C T C G G C A A G C
G | | | | T T
G G A G C
T T A A GGGTC
C - G
A - T
T - A
C - G
A - T
C A
T A
C A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |