Sequence ID | >WENV170745079 |
Genome ID | LULX01036555 |
Search identical group | |
Phylum/Class | [LULX] marine metagenome; Red Sea water column Station 91 - depth 500m |
Species | |
Start position on genome | 183 |
End posion on genome | 108 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
atgcttaatc |
tRNA gene sequence |
GGGCCGTTAGCTCAGTTGGTAGAGCAGCTGGCTTTTAACCAGTTGGTCGAAGGTTCGAAT |
Downstream region at tRNA end position |
tacttatcaa |
Secondary structure (Cloverleaf model) | >WENV170745079 Lys TTT c ACCA tacttatcaa G - C G - C G - C C - G C - G G - C T - A T A T C T T C C A T G A A | | | | | G T C T C G G A A G G C G | | | | T T G G A G C T A A TGGTC G + T C - G T - A G - C G - C C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |