Sequence ID | >WENV170746578 |
Genome ID | LUMA01001716 |
Search identical group | |
Phylum/Class | [LUMA] marine metagenome; Red Sea water column Station 91 - depth 50m |
Species | |
Start position on genome | 2559 |
End posion on genome | 2632 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
cattctataT |
tRNA gene sequence |
TCCTCGGTAGCTCAGCGGTAGAGCGATCGACTGTTAATCGATTGGTCGCAGGTTCGAATC |
Downstream region at tRNA end position |
ataaatacca |
Secondary structure (Cloverleaf model) | >WENV170746578 Asn GTT T GTtt ataaatacca T - A C - G C - G T + G C - G G - C G - C T A T C G C C C A G A A | | | | G C C T C G G C A G G C G | | | | T T G G A G C T A G TGGTC A - T T - A C - G G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |