| Sequence ID | >WENV170747688 |
| Genome ID | LUMD01000016 |
| Phylum/Class | [LUMD] marine metagenome; Red Sea water column Station 34 - depth 258m |
| Species | |
| Start position on genome | 84580 |
| End posion on genome | 84506 |
| Amino Acid | His |
| Anticodon | GTG |
| Upstream region at tRNA start position |
tctctttgtg |
| tRNA gene sequence |
GCCTCTGTCGTCCAATGGCTAGGATAGGGGATTGTGGATCCCCGGATGGGTGTTCGATTC |
| Downstream region at tRNA end position |
taatttttaa |
| Secondary structure (Cloverleaf model) | >WENV170747688 His GTG
g CCCT taatttttaa
G - C
C - G
C - G
T - A
C - G
T - A
G - C T T
T C C C C C A
T A A C | | | | G
G C C T G G G G T G C
G | | | + T T
C G G A T
T A A GGAT
G - C
G - C
G - C
G - C
A - T
T A
T G
G T G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |