Sequence ID | >WENV170748580 |
Genome ID | LUME01000015 |
Search identical group | |
Phylum/Class | [LUME] marine metagenome; Red Sea water column Station 34 - depth 200m |
Species | |
Start position on genome | 5971 |
End posion on genome | 5886 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
atttttctat |
tRNA gene sequence |
GCGGGTATCGCCCAGCCTGGTCAAAGGCGCTAGCTTGAGGGGTTAGTCTCTTAGGAGTTC |
Downstream region at tRNA end position |
attatttctt |
Secondary structure (Cloverleaf model) | >WENV170748580 Leu GAG t ACtg attatttctt G - C C - G G - C G - C G - C T - A A - T T A T C A C C C A C C G A C | | | | | G T C C C G G T G G G C G | | | T T G A G G C T C A A G TCTCTTAGGAGTTC C - G T - A A - T G + T C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |