Sequence ID | >WENV170748940 |
Genome ID | LUME01005024 |
Search identical group | |
Phylum/Class | [LUME] marine metagenome; Red Sea water column Station 34 - depth 200m |
Species | |
Start position on genome | 1911 |
End posion on genome | 1835 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
gaaacgatat |
tRNA gene sequence |
GCTCCGATAGCTCAGCCTGGTAGAGCGTTACATTGGTAATGTAAAGGTCGTGGGTTCAGA |
Downstream region at tRNA end position |
ataattctta |
Secondary structure (Cloverleaf model) | >WENV170748940 Thr GGT t TTCA ataattctta G - C C - G T - A C - G C - G G - C A - T T A T C G C C C G C G A A | + | | | A C C T C G G T G G G C T | | | | T T G G A G C G T A G AGGTC T - A T - A A - T C - G A - T T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |