| Sequence ID | >WENV170750944 |
| Genome ID | LUMH01006733 |
| Phylum/Class | [LUMH] marine metagenome; Red Sea water column Station 34 - depth 25m |
| Species | |
| Start position on genome | 959 |
| End posion on genome | 883 |
| Amino Acid | Ile |
| Anticodon | GAT |
| Upstream region at tRNA start position |
caggatattc |
| tRNA gene sequence |
GGGTCTGTAGCTCAGCTGGTTAGAGCGCACCCCTGATAAGGGTGAGGTCGGAAGTTCAAA |
| Downstream region at tRNA end position |
gttttgaaaa |
| Secondary structure (Cloverleaf model) | >WENV170750944 Ile GAT
c ACCA gttttgaaaa
G - C
G - C
G - C
T - A
C - G
T - A
G - C T A
T C C T T C A
C G A A | | | | | A
T C T C G G G A A G C
G | | | | T T
G G A G C
T T A G AGGTC
C - G
A - T
C - G
C - G
C - G
C A
T A
G A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |