| Sequence ID | >WENV170752740 |
| Genome ID | LUMJ01003217 |
| Phylum/Class | [LUMJ] marine metagenome; Red Sea water column Station 22 - depth 500m |
| Species | |
| Start position on genome | 1862 |
| End posion on genome | 1786 |
| Amino Acid | Met |
| Anticodon | CAT |
| Upstream region at tRNA start position |
cacctacaga |
| tRNA gene sequence |
TGCGGGGTGGAGCAGTCTGGCAGCTCGTCGGGCTCATAACCCGAAGGTCGCAGGTTCAAA |
| Downstream region at tRNA end position |
tttttttggt |
| Secondary structure (Cloverleaf model) | >WENV170752740 Met CAT
a ACCA tttttttggt
T T
G - C
C - G
G - C
G - C
G - C
G - C T A
T C G T C C A
T G A G | | | | | A
C C G A G G C A G G C
T | | | | T T
G G C T C
G C A G AGGTC
T - A
C - G
G - C
G - C
G - C
C A
T A
C A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |