Sequence ID | >WENV170753826 |
Genome ID | LUMK01009473 |
Search identical group | |
Phylum/Class | [LUMK] marine metagenome; Red Sea water column Station 22 - depth 200m |
Species | |
Start position on genome | 1139 |
End posion on genome | 1065 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
aaaaactcat |
tRNA gene sequence |
GCCGCCCTAGCTCAGCGTGGTAGAGCGTCGGACTGTTAATCCGTTGGTCGTCAGTTCAAG |
Downstream region at tRNA end position |
taatatttct |
Secondary structure (Cloverleaf model) | >WENV170753826 Asn GTT t GCac taatatttct G - C C - G C - G G - C C - G C - G C - G T G T C A G T C A C G A A | | | | | A G C T C G G T C A G C T | | | | T T G G A G C G T A G TGGTC T T C - G G - C G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |