| Sequence ID | >WENV170754090 |
| Genome ID | LUML01000051 |
| Phylum/Class | [LUML] marine metagenome; Red Sea water column Station 22 - depth 10m |
| Species | |
| Start position on genome | 3918 |
| End posion on genome | 3841 |
| Amino Acid | Val |
| Anticodon | TAC |
| Upstream region at tRNA start position |
gcattttggc |
| tRNA gene sequence |
GGGCTCGTAGTCTAGCTCGGTTATGACGTCGCCCTTACACGGCGAAGATCCGGTGTTCAA |
| Downstream region at tRNA end position |
ccgaatattt |
| Secondary structure (Cloverleaf model) | >WENV170754090 Val TAC
c ACTA ccgaatattt
G - C
G - C
G - C
C - G
T + G
C - G
G - C T A
T G C C A C A
T C G A A | | | | | A
C T C T G C G G T G C
G | | | T T
G T G A C
T T A G AGATC
T - A
C - G
G - C
C - G
C - G
C C
T A
T A C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |