| Sequence ID | >WENV170756514 |
| Genome ID | LUMP01000052 |
| Phylum/Class | [LUMP] marine metagenome; Red Sea water column Station 12 - depth 47m |
| Species | |
| Start position on genome | 24850 |
| End posion on genome | 24777 |
| Amino Acid | Cys |
| Anticodon | GCA |
| Upstream region at tRNA start position |
aactaaaaat |
| tRNA gene sequence |
GGCTGGGTAGCAAAGCGGTTATGCAGGGGCCTGCAAAGCCTTTTAGACCGGTTCGACTCC |
| Downstream region at tRNA end position |
ttattcatta |
| Secondary structure (Cloverleaf model) | >WENV170756514 Cys GCA
t TCCA ttattcatta
G - C
G - C
C - G
T - A
G - C
G - C
G - C T C
T T G G C C A
G A A | | | | | G
C A A C G A C C G G C
G | | | T T
G A T G C
T T A TTAG
G + T
G + T
G - C
G - C
C - G
C A
T A
G C A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |