| Sequence ID | >WENV170756637 |
| Genome ID | LUMP01000331 |
| Phylum/Class | [LUMP] marine metagenome; Red Sea water column Station 12 - depth 47m |
| Species | |
| Start position on genome | 7458 |
| End posion on genome | 7534 |
| Amino Acid | Gly |
| Anticodon | TCC |
| Upstream region at tRNA start position |
caatccttaT |
| tRNA gene sequence |
GCAGTCATAGTATAGCCTGGTTAGTATTCGGGGTTTCCAACCCTGTGACGCGGGTTCGAA |
| Downstream region at tRNA end position |
attcatttat |
| Secondary structure (Cloverleaf model) | >WENV170756637 Gly TCC
T ATCt attcatttat
G - C
C - G
A - T
G - C
T - A
C - G
A - T T A
T C G C C C A
C C G A A | | | | | G
T T A T G G C G G G C
G + | | + T T
G G T A T
T T A T TGAC
C - G
G + T
G - C
G - C
G - C
T A
T A
T C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |