Sequence ID | >WENV170757573 |
Genome ID | LUMQ01003721 |
Search identical group | |
Phylum/Class | [LUMQ] marine metagenome; Red Sea water column Station 12 - depth 25m |
Species | |
Start position on genome | 2308 |
End posion on genome | 2233 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
attatctttc |
tRNA gene sequence |
GCGAGTATAGCTCAGCTGGTAGAGCGCGACCTTGCCAAGGTCGAGGCCACGGGTTCGAAC |
Downstream region at tRNA end position |
ttacaataaa |
Secondary structure (Cloverleaf model) | >WENV170757573 Gly GCC c TCCA ttacaataaa G - C C - G G - C A - T G - C T - A A - T C A T T G C C C A C G A A | | | | | G T C T C G A C G G G C G | | | | T T G G A G C T A G AGGCC C - G G - C A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |