| Sequence ID | >WENV170757577 |
| Genome ID | LUMQ01003779 |
| Phylum/Class | [LUMQ] marine metagenome; Red Sea water column Station 12 - depth 25m |
| Species | |
| Start position on genome | 2812 |
| End posion on genome | 2739 |
| Amino Acid | Ala |
| Anticodon | TGC |
| Upstream region at tRNA start position |
ccctgatatt |
| tRNA gene sequence |
GGGGGTATAGCTCAGTTGGTAGAGCGCCTGCTTTGCAAGCAGGATGTCAGCGGTTCGAGT |
| Downstream region at tRNA end position |
attaccacct |
| Secondary structure (Cloverleaf model) | >WENV170757577 Ala TGC
t ACtg attaccacct
G - C
G - C
G + T
G - C
G - C
T - A
A - T T G
T T C G C C A
T G A A | | | | | G
T C T C G A G C G G C
G | | | | T T
G G A G C
T A G ATGTC
C - G
C - G
T - A
G - C
C - G
T A
T A
T G C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |