| Sequence ID | >WENV170757700 |
| Genome ID | LUMQ01006872 |
| Phylum/Class | [LUMQ] marine metagenome; Red Sea water column Station 12 - depth 25m |
| Species | |
| Start position on genome | 577 |
| End posion on genome | 651 |
| Amino Acid | Phe |
| Anticodon | GAA |
| Upstream region at tRNA start position |
gcttttccat |
| tRNA gene sequence |
GCCCGGGTAGCTCAGGGGTAGAGCAGTGGACTGAAAATCCTCGTGTCGGTGGTTCAAATC |
| Downstream region at tRNA end position |
cggaatctag |
| Secondary structure (Cloverleaf model) | >WENV170757700 Phe GAA
t ACCA cggaatctag
G - C
C - G
C - G
C - G
G - C
G - C
G - C T A
T C C G C C A
G A A | | + | | A
G C T C G G G T G G C
G | | | | T T
G G A G C
T A A GTGTC
G - C
T T
G - C
G - C
A - T
C A
T A
G A A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |