| Sequence ID | >WENV170757844 |
| Genome ID | LUMQ01012248 |
| Phylum/Class | [LUMQ] marine metagenome; Red Sea water column Station 12 - depth 25m |
| Species | |
| Start position on genome | 672 |
| End posion on genome | 747 |
| Amino Acid | Trp |
| Anticodon | CCA |
| Upstream region at tRNA start position |
aggtccgcgt |
| tRNA gene sequence |
AGGGGTATAGCTCAGCTGGTAGAGCGACGGTCTCCAAAACCGTAGGTCGCGGGTTCGAAC |
| Downstream region at tRNA end position |
actgcaccct |
| Secondary structure (Cloverleaf model) | >WENV170757844 Trp CCA
t GCCA actgcaccct
A - T
G - C
G - C
G - C
G - C
T + G
A - T C A
T C G T C C A
C G A A | | + | | G
T C T C G G C G G G C
G | | | | T T
G G A G C
T A G AGGTC
A - T
C - G
G - C
G - C
T - A
C A
T A
C C A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |