| Sequence ID | >WENV170759505 |
| Genome ID | LUMT01000002 |
| Phylum/Class | [LUMT] marine metagenome; Red Sea water column Station 192 - depth 50m |
| Species | |
| Start position on genome | 720633 |
| End posion on genome | 720709 |
| Amino Acid | Arg |
| Anticodon | ACG |
| Upstream region at tRNA start position |
accgctccac |
| tRNA gene sequence |
GCACCCGTAGCTCAGCTGGATAGAGCATCAGACTACGAATCTGAGGGTCGGACGTTCGAA |
| Downstream region at tRNA end position |
tttcccttcg |
| Secondary structure (Cloverleaf model) | >WENV170759505 Arg ACG
c GCCA tttcccttcg
G - C
C - G
A - T
C - G
C - G
C - G
G - C T A
T C T T G C A
C G A A | + | | | G
T C T C G G G A C G C
G | | | | T T
G G A G C
A T A A GGGTC
T - A
C - G
A - T
G - C
A - T
C A
T A
A C G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |