| Sequence ID | >WENV170760759 |
| Genome ID | LUMU01000064 |
| Phylum/Class | [LUMU] marine metagenome; Red Sea water column Station 192 - depth 100m |
| Species | |
| Start position on genome | 41272 |
| End posion on genome | 41345 |
| Amino Acid | Pro |
| Anticodon | TGG |
| Upstream region at tRNA start position |
gcccgcttgg |
| tRNA gene sequence |
CGGGGCGTAGCGTAGTGGCTAGCGCGCCTGCTTTGGGAGCAGGAGATCGCAGGTTCGAGT |
| Downstream region at tRNA end position |
cctcacccgt |
| Secondary structure (Cloverleaf model) | >WENV170760759 Pro TGG
g ACag cctcacccgt
C - G
G - C
G - C
G - C
G - C
C - G
G - C T G
T T G T C C A
T G A A + | | | | G
G T G C G G C A G G C
G + | | | T T
C G C G C
T A G AGATC
C - G
C - G
T - A
G - C
C - G
T A
T G
T G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |