| Sequence ID | >WENV170760801 |
| Genome ID | LUMU01000207 |
| Phylum/Class | [LUMU] marine metagenome; Red Sea water column Station 192 - depth 100m |
| Species | |
| Start position on genome | 6944 |
| End posion on genome | 7018 |
| Amino Acid | Ile |
| Anticodon | GAT |
| Upstream region at tRNA start position |
agccggcggc |
| tRNA gene sequence |
GGGCCTATAGCTCAGACGGTTAGAGCGCTTCCCTGATAAGGAAGAGGTCACAGGTTCAAG |
| Downstream region at tRNA end position |
cacaccccgg |
| Secondary structure (Cloverleaf model) | >WENV170760801 Ile GAT
c ACtc cacaccccgg
G - C
G - C
G - C
C - G
C - G
T - A
A - T T G
T T G T C C A
A G A A | | | | | A
C C T C G A C A G G C
G | | | | T T
G G A G C
T T A G AGGTC
C - G
T - A
T - A
C - G
C - G
C A
T A
G A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |