| Sequence ID | >WENV170761247 |
| Genome ID | LUMU01023949 |
| Phylum/Class | [LUMU] marine metagenome; Red Sea water column Station 192 - depth 100m |
| Species | |
| Start position on genome | 15 |
| End posion on genome | 92 |
| Amino Acid | Asp |
| Anticodon | GTC |
| Upstream region at tRNA start position |
tgtaaatact |
| tRNA gene sequence |
GCCCTTGTAGTATAGCCCGGTCTAGAATTCGGCCCTGTCACGGCTGAGACGCGGGTTCAA |
| Downstream region at tRNA end position |
tttctttttc |
| Secondary structure (Cloverleaf model) | >WENV170761247 Asp GTC
t GCCA tttctttttc
G - C
C - G
C - G
C - G
T - A
T + G
G - C T A
T C G C C C A
C C G A A | | | | | A
C T A T G G C G G G C
G + | + T T
G G A A T
T C T A T AGAC
C - G
G + T
G - C
C - G
C - G
C C
T A
G T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |