| Sequence ID | >WENV170763990 |
| Genome ID | LWDU01026765 |
| Phylum/Class | [LWDU] hydrothermal vent metagenome; deep sea hydrothermal plume seawater |
| Species | |
| Start position on genome | 12 |
| End posion on genome | 85 |
| Amino Acid | His |
| Anticodon | GTG |
| Upstream region at tRNA start position |
tttttttgtg |
| tRNA gene sequence |
GCCCTCGTAGTACAGTGGTTAGTATAGAGGATTGTGGATCCTCGGACGGGAGTTCGATTC |
| Downstream region at tRNA end position |
atagtatatt |
| Secondary structure (Cloverleaf model) | >WENV170763990 His GTG
g CCAt atagtatatt
G - C
C - G
C - G
C - G
T - A
C - G
G - C T T
T C C C C C A
T G A A | | | | G
G C A T G G G G A G C
G | | | + T T
T G T A T
T A A GGAC
G - C
A - T
G - C
G - C
A - T
T A
T G
G T G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |