Sequence ID | >WENV170767283 |
Genome ID | LXNH01000343 |
Search identical group | |
Phylum/Class | [LXNH] seawater metagenome; marine seawater |
Species | |
Start position on genome | 6322 |
End posion on genome | 6246 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
cacacaccgc |
tRNA gene sequence |
GCGGCAGTAGCTCAGTTGGATAGAGCACGGGCCTTCTAAGCCTGAGGTCGGGGGTTCGAT |
Downstream region at tRNA end position |
gaaagcctaa |
Secondary structure (Cloverleaf model) | >WENV170767283 Arg TCT c GCCA gaaagcctaa G - C C - G G - C G - C C - G A - T G - C C T T C T C C C A T G A A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C A T A A AGGTC C - G G + T G - C G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |