| Sequence ID | >WENV170769253 |
| Genome ID | LXNH01047598 |
| Phylum/Class | [LXNH] seawater metagenome; marine seawater |
| Species | |
| Start position on genome | 1086 |
| End posion on genome | 1174 |
| Amino Acid | Ser |
| Anticodon | TGA |
| Upstream region at tRNA start position |
gctgaccccT |
| tRNA gene sequence |
GGAGAGGTGGTCGAGTGGTTTATGGCTCTGGTCTTGAAAACCAGCGTGTCTTCACGGGCA |
| Downstream region at tRNA end position |
atagaaacaa |
| Secondary structure (Cloverleaf model) | >WENV170769253 Ser TGA
T GTtg atagaaacaa
G - C
G - C
A - T
G - C
A - T
G - C
G - C T A
T C A C C C A
T G A G | | | | | G
G G C T G G T G G G C
G + | + | T T
T T G G C
T T A T CGTGTCTTCACGGGCACC
C - G
T - A
G - C
G - C
T - A
C A
T A
T G A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |