Sequence ID | >WENV170781129 |
Genome ID | MAAB01029445 |
Search identical group | |
Phylum/Class | [MAAB] seawater metagenome; sample BD02T18 sea water enriched with oil for 18 days |
Species | |
Start position on genome | 426 |
End posion on genome | 351 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
agatagcaat |
tRNA gene sequence |
TCCCCAATAGCTCAGTTGGTAGAGCGATGGACTGTTAATCCATGTGTCACTGGTTCGAGC |
Downstream region at tRNA end position |
catttaaaaa |
Secondary structure (Cloverleaf model) | >WENV170781129 Asn GTT t GCCA catttaaaaa T - A C - G C - G C - G C - G A - T A - T C G T T G A C C A T G A A | | | | | G T C T C G A C T G G C G | | | | T T G G A G C T A G GTGTC A - T T - A G - C G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |