Sequence ID | >WENV170781846 |
Genome ID | MAAC01002248 |
Search identical group | |
Phylum/Class | [MAAC] seawater metagenome; sample BD02T64 sea water enriched with oil for 64 days |
Species | |
Start position on genome | 88 |
End posion on genome | 14 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
taaaaactac |
tRNA gene sequence |
GGGCTCGTAGCTCAGCTGGATAGAGCACCTCCCTTCTAAGGAGGCGGTCATAGGTTCGAA |
Downstream region at tRNA end position |
aaagcttcac |
Secondary structure (Cloverleaf model) | >WENV170781846 Arg TCT c ACat aaagcttcac G - C G + T G - C C - G T + G C - G G - C T A T T A T C C A C G A A | | | | | G T C T C G A T A G G C G | | | | T T G G A G C A T A A CGGTC C - G C - G T - A C - G C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |