| Sequence ID | >WENV170781896 |
| Genome ID | MAAC01003701 |
| Phylum/Class | [MAAC] seawater metagenome; sample BD02T64 sea water enriched with oil for 64 days |
| Species | |
| Start position on genome | 32 |
| End posion on genome | 116 |
| Amino Acid | Leu |
| Anticodon | TAG |
| Upstream region at tRNA start position |
cactcctttt |
| tRNA gene sequence |
GCAGGCGTGGTGGAATTGGTAGACACGCTAGACTTAGGATCTAGTGCCGCGAGGTGTGAG |
| Downstream region at tRNA end position |
aagagaaagc |
| Secondary structure (Cloverleaf model) | >WENV170781896 Leu TAG
t ACAA aagagaaagc
G + T
C - G
A - T
G - C
G - C
C - G
G - C T G
T C T C T C A
T A A G | | | | | G
T G G T G G A G A G C
G | | | T T
G A C A C
T A G G TGCCGCGAGGTGT
C - G
T - A
A - T
G - C
A - T
C A
T G
T A G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |