| Sequence ID | >WENV170782472 |
| Genome ID | MAAC01010131 |
| Phylum/Class | [MAAC] seawater metagenome; sample BD02T64 sea water enriched with oil for 64 days |
| Species | |
| Start position on genome | 1568 |
| End posion on genome | 1483 |
| Amino Acid | Leu |
| Anticodon | TAA |
| Upstream region at tRNA start position |
attgtccgat |
| tRNA gene sequence |
GCCCGGGTGGTGGAATTGGTAGACACAAGGGATTTAAAATCCCTCGCTCTTAGAGTGTGA |
| Downstream region at tRNA end position |
cctttattac |
| Secondary structure (Cloverleaf model) | >WENV170782472 Leu TAA
t ACCA cctttattac
G + T
C - G
C - G
C - G
G - C
G - C
G + T T G
T C T G C C A
T A A G | | | | | A
T G G T G G A C G G C
G | | | T T
G A C A C
T A G A CGCTCTTAGAGTGT
A - T
G - C
G - C
G - C
A - T
T A
T A
T A A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |