| Sequence ID | >WENV170782671 |
| Genome ID | MAAC01011126 |
| Phylum/Class | [MAAC] seawater metagenome; sample BD02T64 sea water enriched with oil for 64 days |
| Species | |
| Start position on genome | 62401 |
| End posion on genome | 62477 |
| Amino Acid | Pro |
| Anticodon | TGG |
| Upstream region at tRNA start position |
taccacattt |
| tRNA gene sequence |
CGGGGTATAGCGCAGCCTGGTAGCGCGCCTGCTTTGGGAGCAGGATGTCGGGAGTTCAAA |
| Downstream region at tRNA end position |
atatgatgca |
| Secondary structure (Cloverleaf model) | >WENV170782671 Pro TGG
t ACCA atatgatgca
C - G
G - C
G - C
G - C
G - C
T - A
A - T T A
T C T C T C A
C G A A | + | | | A
C C G C G G G G A G C
T | | | | T T
G G C G C
G T A G ATGTC
C - G
C - G
T - A
G - C
C - G
T A
T G
T G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |