Sequence ID | >WENV170783253 |
Genome ID | MAAC01015387 |
Search identical group | |
Phylum/Class | [MAAC] seawater metagenome; sample BD02T64 sea water enriched with oil for 64 days |
Species | |
Start position on genome | 21984 |
End posion on genome | 21909 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
ctctaatgaa |
tRNA gene sequence |
GCGGCTGTAGCTCAGCTGGTAGAGCATCACGTTGCCAACGTGAATGTCACGAGTTCGAGT |
Downstream region at tRNA end position |
aattttaagc |
Secondary structure (Cloverleaf model) | >WENV170783253 Gly GCC a TCCA aattttaagc G - C C - G G - C G - C C - G T - A G + T T G T T G C T C A C G A A | | | | | G T C T C G A C G A G C G | | | | T T G G A G C T A A ATGTC T - A C - G A - T C - G G - C T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |