| Sequence ID | >WENV170783406 |
| Genome ID | MAAC01016649 |
| Phylum/Class | [MAAC] seawater metagenome; sample BD02T64 sea water enriched with oil for 64 days |
| Species | |
| Start position on genome | 12616 |
| End posion on genome | 12542 |
| Amino Acid | Gly |
| Anticodon | GCC |
| Upstream region at tRNA start position |
taaagcaatt |
| tRNA gene sequence |
GCGAAAGTAGCTCAGGGGTAGAGCATCACCTTGCCAAGGTGGAGGTCGCGAGTTCAAATC |
| Downstream region at tRNA end position |
aaaactgttc |
| Secondary structure (Cloverleaf model) | >WENV170783406 Gly GCC
t TCTA aaaactgttc
G - C
C - G
G - C
A - T
A - T
A - T
G - C T A
T T G C T C A
G A A + | | | | A
G C T C G G C G A G C
G | | | | T T
G G A G C
T A A AGGTC
T + G
C - G
A - T
C - G
C - G
T A
T A
G C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |