| Sequence ID | >WENV170783428 |
| Genome ID | MAAC01016802 |
| Phylum/Class | [MAAC] seawater metagenome; sample BD02T64 sea water enriched with oil for 64 days |
| Species | |
| Start position on genome | 1777 |
| End posion on genome | 1852 |
| Amino Acid | Gly |
| Anticodon | TCC |
| Upstream region at tRNA start position |
aaataagaat |
| tRNA gene sequence |
GCGAAAGTAGCTCAGTTGGTAGAGCGTCAGCCTTCCAAGCTGAATGTCGCCGGTTCGAAC |
| Downstream region at tRNA end position |
gtttttaagc |
| Secondary structure (Cloverleaf model) | >WENV170783428 Gly TCC
t TCTA gtttttaagc
G - C
C - G
G - C
A - T
A - T
A - T
G - C C A
T T G G C C A
T G A A + | | | | G
T C T C G G C C G G C
G | | | | T T
G G A G C
T A G ATGTC
T - A
C - G
A - T
G - C
C - G
C A
T A
T C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |