| Sequence ID | >WENV170783482 |
| Genome ID | MAAC01017442 |
| Phylum/Class | [MAAC] seawater metagenome; sample BD02T64 sea water enriched with oil for 64 days |
| Species | |
| Start position on genome | 95706 |
| End posion on genome | 95796 |
| Amino Acid | Ser |
| Anticodon | GGA |
| Upstream region at tRNA start position |
taagtttcac |
| tRNA gene sequence |
AGAGAGGTGGCCGAGTGGTCGAAGGCGCACGCCTGGAAAGTGTGTATACGTCAAAAGCGT |
| Downstream region at tRNA end position |
aaggtttggt |
| Secondary structure (Cloverleaf model) | >WENV170783482 Ser GGA
c GCAA aaggtttggt
A - T
G - C
A - T
G - C
A - T
G - C
G - C T A
T T T C C C A
T G A G + + | | | G
G G C C G G G G G G C
G | | | T T
T A G G C
C G A G TATACGTCAAAAGCGTATC
C - G
A - T
C - G
G + T
C - G
C A
T A
G G A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |