| Sequence ID | >WENV170783517 |
| Genome ID | MAAC01017494 |
| Phylum/Class | [MAAC] seawater metagenome; sample BD02T64 sea water enriched with oil for 64 days |
| Species | |
| Start position on genome | 32602 |
| End posion on genome | 32674 |
| Amino Acid | Thr |
| Anticodon | GGT |
| Upstream region at tRNA start position |
agtttttatc |
| tRNA gene sequence |
GCCGGTGTAGCTCAGGGGTAGAGCGTTTCCTTGGTAAGGAAGAGGTCACGGGTTCAAATC |
| Downstream region at tRNA end position |
ttaaaggtta |
| Secondary structure (Cloverleaf model) | >WENV170783517 Thr GGT
c TCtt ttaaaggtta
G - C
C - G
C - G
G + T
G + T
T - A
G - C T A
T T G C C C A
G A A | | | | | A
G C T C G A C G G G C
G | | | | T T
G G A G C
T A G AGGTC
T + G
T - A
T - A
C - G
C - G
T A
T A
G G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |