| Sequence ID | >WENV170783526 |
| Genome ID | MAAC01017527 |
| Phylum/Class | [MAAC] seawater metagenome; sample BD02T64 sea water enriched with oil for 64 days |
| Species | |
| Start position on genome | 15 |
| End posion on genome | 89 |
| Amino Acid | Arg |
| Anticodon | TCT |
| Upstream region at tRNA start position |
taaaaactac |
| tRNA gene sequence |
GGGCTCGTAGCTCAGCTGGATAGAGCACCTCCCTTCTAAGGAGGCGGTCATAGGTTCGAA |
| Downstream region at tRNA end position |
aaagtcttgt |
| Secondary structure (Cloverleaf model) | >WENV170783526 Arg TCT
c ACat aaagtcttgt
G - C
G + T
G - C
C - G
T + G
C - G
G - C T A
T T A T C C A
C G A A | | | | | G
T C T C G A T A G G C
G | | | | T T
G G A G C
A T A A CGGTC
C - G
C - G
T - A
C - G
C - G
C A
T A
T C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |