| Sequence ID | >WENV170783677 |
| Genome ID | MAAC01018369 |
| Phylum/Class | [MAAC] seawater metagenome; sample BD02T64 sea water enriched with oil for 64 days |
| Species | |
| Start position on genome | 7272 |
| End posion on genome | 7346 |
| Amino Acid | Gln |
| Anticodon | TTG |
| Upstream region at tRNA start position |
tttacattgt |
| tRNA gene sequence |
TGGGATATAGCCAAGCGGTAAGGCAGCGGGTTTTGATCCCGTCATTCCGAGGTTCAAATC |
| Downstream region at tRNA end position |
atctttttga |
| Secondary structure (Cloverleaf model) | >WENV170783677 Gln TTG
t GCCA atctttttga
T - A
G - C
G - C
G - C
A - T
T - A
A - T T A
T G C T C C A
G A A | | | | | A
C A C C G C G A G G C
G | | | T T
G A G G C
T A A CATTC
G + T
C - G
G - C
G - C
G - C
T T
T A
T T G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |