| Sequence ID | >WENV170783737 |
| Genome ID | MAAC01018473 |
| Phylum/Class | [MAAC] seawater metagenome; sample BD02T64 sea water enriched with oil for 64 days |
| Species | |
| Start position on genome | 28943 |
| End posion on genome | 28869 |
| Amino Acid | Gly |
| Anticodon | GCC |
| Upstream region at tRNA start position |
ccaacggaat |
| tRNA gene sequence |
GCGGGCGTAGCTCAGGGGTAGAGCATAACCTTGCCAAGGTTAGGGTCGAGAGTTCGAATC |
| Downstream region at tRNA end position |
gttggaccac |
| Secondary structure (Cloverleaf model) | >WENV170783737 Gly GCC
t TCCA gttggaccac
G - C
C - G
G - C
G - C
G - C
C - G
G - C T A
T T T C T C A
G A A + | | | | G
G C T C G G A G A G C
G | | | | T T
G G A G C
T A A GGGTC
T - A
A - T
A - T
C - G
C - G
T A
T A
G C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |