| Sequence ID | >WENV170783785 |
| Genome ID | MAAC01018793 |
| Phylum/Class | [MAAC] seawater metagenome; sample BD02T64 sea water enriched with oil for 64 days |
| Species | |
| Start position on genome | 367 |
| End posion on genome | 292 |
| Amino Acid | Ala |
| Anticodon | GGC |
| Upstream region at tRNA start position |
cttcctttcg |
| tRNA gene sequence |
GGGGCTATAGCTCAGCTGGGAGAGCGCTTGCATGGCATGCAAGAGGTCGGCGGTTCGATC |
| Downstream region at tRNA end position |
gcattaccga |
| Secondary structure (Cloverleaf model) | >WENV170783785 Ala GGC
g ACCA gcattaccga
G - C
G - C
G + T
G - C
C - G
T - A
A - T C T
T C C G C C A
C G A A | | | | | G
T C T C G G G C G G C
G | | | | T T
G G A G C
G A G AGGTC
C - G
T - A
T - A
G - C
C - G
A T
T A
G G C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |