| Sequence ID | >WENV170783830 |
| Genome ID | MAAC01019132 |
| Phylum/Class | [MAAC] seawater metagenome; sample BD02T64 sea water enriched with oil for 64 days |
| Species | |
| Start position on genome | 1445 |
| End posion on genome | 1370 |
| Amino Acid | Thr |
| Anticodon | GGT |
| Upstream region at tRNA start position |
aagatttgtt |
| tRNA gene sequence |
GCTGATATAGCTCAGTTGGTAGAGTGCATCCTTGGTAAGGATGAGGTCGGCAGTTCGAAT |
| Downstream region at tRNA end position |
gtattcaaca |
| Secondary structure (Cloverleaf model) | >WENV170783830 Thr GGT
t ACCA gtattcaaca
G - C
C - G
T - A
G - C
A - T
T - A
A - T T A
T C C G T C A
T G A A | | | | | G
T C T C G G G C A G C
G | | | + T T
G G A G T
T A G AGGTC
C - G
A - T
T - A
C - G
C - G
T A
T A
G G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |