Sequence ID | >WENV170784025 |
Genome ID | MCHG01000001 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 1105 |
End posion on genome | 1030 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
gggatgatcc |
tRNA gene sequence |
GCCCACATAGCTCAGTCGGTAGAGCACTTCCTTGGTAAGGAAGAGGTCACCGGTTCAAGT |
Downstream region at tRNA end position |
cgtgtacaaa |
Secondary structure (Cloverleaf model) | >WENV170784025 Thr GGT c TCCA cgtgtacaaa G - C C - G C - G C - G A - T C - G A - T T G T T G G C C A T G A A | | | | | A C C T C G A C C G G C G | | | | T T G G A G C T A A AGGTC C - G T - A T - A C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |