Sequence ID | >WENV170784028 |
Genome ID | MCHG01000002 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 202548 |
End posion on genome | 202624 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
gccttcgcga |
tRNA gene sequence |
CGCGGGGTGGAGCAGCTCGGTAGCTCGCTGGGCTCATAACCCAGAGGTCACAGGTTCAAA |
Downstream region at tRNA end position |
atgggaaccc |
Secondary structure (Cloverleaf model) | >WENV170784028 Met CAT a ACGA atgggaaccc C T G - C C - G G - C G - C G - C G - C T A T T G T C C A C G A G | | | | | A T C G A G A C A G G C C | | | | T T G G C T C G T A G AGGTC C - G T - A G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |