Sequence ID | >WENV170784052 |
Genome ID | MCHG01000004 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 540654 |
End posion on genome | 540583 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
ggctctcgcc |
tRNA gene sequence |
GGTGGAGTGGCCGAGAGGCGAGGCAACGGACTGCAAATCCGTGTACACGGGTTCAAATCC |
Downstream region at tRNA end position |
gacgagtgaa |
Secondary structure (Cloverleaf model) | >WENV170784052 Cys GCA c TCtc gacgagtgaa G - C G - C T - A G - C G - C A - T G - C T A T T G C C C A G A G | | | | | A A G C C G A C G G G C G | | | T T G A G G C C G A GTAC A - T C - G G - C G - C A - T C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |