Sequence ID | >WENV170784071 |
Genome ID | MCHG01000005 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 108805 |
End posion on genome | 108731 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
tccgcgcagc |
tRNA gene sequence |
GGTCCCTTCGTCTATCGGTTAGGACGTCAGGTTTTCAACCTGAAGAGAGGGGTTCGACTC |
Downstream region at tRNA end position |
cgcggagctt |
Secondary structure (Cloverleaf model) | >WENV170784071 Glu TTC c GCCA cgcggagctt G + T G - C T - A C - G C - G C - G T - A T C T T C C C C A C T A C | | | | | G G T C T G A G G G G C G + | | | T T T G G A C T A G AGAG T - A C - G A - T G - C G - C T A T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |