Sequence ID | >WENV170784137 |
Genome ID | MCHG01000033 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 1251 |
End posion on genome | 1327 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tcgtttaatt |
tRNA gene sequence |
GGGCCTTTAGCTCAGTTGGTTAGAGCAACCGGCTCATAACCGGTTGGTCCGGGGTTCGAG |
Downstream region at tRNA end position |
tattaaaatg |
Secondary structure (Cloverleaf model) | >WENV170784137 Met CAT t ACCA tattaaaatg G - C G - C G - C C - G C - G T - A T - A T G T G T C C C A T G A A | + | | | G T C T C G C G G G G C G | | | | T T G G A G C T T A A TGGTC A - T C - G C - G G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |