Sequence ID | >WENV170784150 |
Genome ID | MCHG01000044 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 68369 |
End posion on genome | 68445 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tcccgtaagg |
tRNA gene sequence |
GGTTGGGTAGCTCAGATGGTTAGAGCGGTGGATTCATAACCCACAGGTCGGCGGTTCGAT |
Downstream region at tRNA end position |
cggatttccc |
Secondary structure (Cloverleaf model) | >WENV170784150 Met CAT g ACCA cggatttccc G - C G - C T - A T - A G - C G - C G + T C T T C C G C C A A G A A | | | | | G T C T C G G G C G G C G | | | | T T G G A G C T T A G AGGTC G - C T - A G - C G - C A C T A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |