Sequence ID | >WENV170784194 |
Genome ID | MCHG01000107 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 39905 |
End posion on genome | 39830 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
aaagcaaatt |
tRNA gene sequence |
GGGCTCGTGGCTTAGCCTGGATATAGCGCTGGGCTTCTAACCCAGACGTCGGGGGTTCAA |
Downstream region at tRNA end position |
atcccttttg |
Secondary structure (Cloverleaf model) | >WENV170784194 Arg TCT t GCtt atcccttttg G - C G - C G - C C - G T - A C - G G - C T A T T T C C C A C C G A G + + | | | A T T T C G G G G G G C G | | | T T G T A G C A T A G ACGTC C - G T - A G - C G - C G - C C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |