| Sequence ID | >WENV170784194 |
| Genome ID | MCHG01000107 |
| Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
| Species | |
| Start position on genome | 39905 |
| End posion on genome | 39830 |
| Amino Acid | Arg |
| Anticodon | TCT |
| Upstream region at tRNA start position |
aaagcaaatt |
| tRNA gene sequence |
GGGCTCGTGGCTTAGCCTGGATATAGCGCTGGGCTTCTAACCCAGACGTCGGGGGTTCAA |
| Downstream region at tRNA end position |
atcccttttg |
| Secondary structure (Cloverleaf model) | >WENV170784194 Arg TCT
t GCtt atcccttttg
G - C
G - C
G - C
C - G
T - A
C - G
G - C T A
T T T C C C A
C C G A G + + | | | A
T T T C G G G G G G C
G | | | T T
G T A G C
A T A G ACGTC
C - G
T - A
G - C
G - C
G - C
C A
T A
T C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |