Sequence ID | >WENV170784196 |
Genome ID | MCHG01000109 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 18891 |
End posion on genome | 18966 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
actatttttt |
tRNA gene sequence |
AGGGGTATAGCTCAGTTGGTAGAGCAGTGGTCTCCAAAACCACGTGCCGATGGTTCAAGT |
Downstream region at tRNA end position |
aatttaataa |
Secondary structure (Cloverleaf model) | >WENV170784196 Trp CCA t GCCA aatttaataa A - T G - C G - C G - C G - C T - A A - T T G T C T T C C A T G A A | | | | A T C T C G G A T G G C G | | | | T T G G A G C T A A GTGCC G - C T - A G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |