Sequence ID | >WENV170784198 |
Genome ID | MCHG01000113 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 12264 |
End posion on genome | 12189 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
agaacaacat |
tRNA gene sequence |
GGTCGCATAGCTCAGCTGGGAGAGCACCTGCCTTACAAGCAGGGGGTCATAGGTTCGAGC |
Downstream region at tRNA end position |
ttatttaagt |
Secondary structure (Cloverleaf model) | >WENV170784198 Val TAC t ACCA ttatttaagt G - C G - C T - A C - G G - C C - G A - T C G T T A T C C A C G A A | | | | | G T C T C G A T A G G C G | | | | T T G G A G C G A A GGGTC C - G C - G T - A G - C C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |